A low-cost color sensor device for rapid detection of high-grade serous ovarian carcinoma (HGSOC)

Inorganic Phosphate (Pi) based DNA analysis

The potential application of Pi achieved from amplified DNA. An inorganic pyrophosphate (PPi) is released by DNA polymerase during a dNTP addition process.

After an incubation time of 10 min., there was no Pi observed in the –ve control (Experiment A) and Pi detected in the R.mix (Experiment B) as was expected. However, in the absence of PPase, a slight greenish appearance in the yellow color was observed (Experiment C) which could possibly due to Pi contamination in some reagents possibly in dNTPs or primers. The false positive result problem was solved to use less amount of the magnesium ions related reagent and pyrophosphatase.

In the experiments (A to C) in Table 1, the incubation time was 10 min. So, in order to rule out the longer time related activity of PPase, further experiments were performed with virtually no incubation (0 Sec) or immediate addition of phosphate dye solution (PDS). A bright yellow color was observed in the –ve control (Experiment A) and green color was detected in the R.mix (Experiment B) as was expected. In the absence of PPase, again a light greenish appearance in the yellow color was observed (Experiment C) which could possibly due to Pi contamination. In experiment B, all required reagents were treated with amplified sample and achieved expected result in green color form. The only experiment B sample was tested on Ercose and spectrophotometer and compared for its validation. Experiments D and E in Table 2 also had an expected outcome.

Designing of colorimeter device Ercose using color sensor

The development of a colorimeter utilizing a color sensor allowed for the detection of minute differences between green colors that appear identical to the naked eye. White light from a white light emitting diode (LED) shines on the test solution in the tube, causing color to be formed. This color is then exposed to the color sensor (Figure 1), which produces readings of the colors as red: green: blue (RGB ratios). The arduino nano microcontroller was attached to the color sensor. RGB data was transmitted to a laptop through a USB link and entered into Microsoft Excel using the PLX-DAQ plug-in.

Figure 1. Color sensor based ercose colorimeter (A) Different parts of Ercose colorimeter including color sensor TCS3200, LED, PDMS based sample holding tube (SHT) with covers, and last one is eraser. To made the holes on both side of the covers of color sensor TCS3200, LED and SHT the cross the LED light from SHT to color sensor and achieved the exact result, (B) Color sensor exposed with white light through white LED, (C) Ercose during assembly, (D) Ercose colorimeter in assembled form for testing the amplified HGSOC based Pi for green color readings. The two elastic rubber bands were used to fix the eraser with color sensor TCS3200, LED and SHT at one point.

The developed colorimeter was optimized for detection of green color produced for pi-colorlock gold kit. For this purpose phosphate solutions of different concentrations were prepared starting from 100 with 10 parts reduction of Pi till 10. Data from Ercose color sensor device converted into normalized green and commercial spectrophotometer were obtained (Table 3) and compared to use it for calibration curve.

When Pi concentration increases, the green value also increases, this is expected because malachite green forms a green colored complex with Pi. The relationship between Pi and normalized green is nearly linear between 10–100 μM. The Ercose values were scaled 0 to 1 by dividing 225 (max value in 8 bit sensor):

$$\text{Normalized Green}=\frac{\text{Raw Green}}{225}.$$

Beside the Ercose data is also compared with spectrophotometer for validation.

The calibration curve shown in Figure 2 compares the signal responses of two detection methods. Ercose (Normalized Green) and the spectrophotometer (Absorbance), across a range of Pi concentrations from 10 to 100 μM. The green line with circular markers represents the Ercose sensor’s normalized green intensity, while the blue line with square markers indicates the spectrophotometric absorbance measurements. Both curves show a positive linear trend, indicating that as Pi concentration increases, the signal intensity for both methods also increases. This behavior confirms that both detection systems are sensitive to changes in Pi concentration. The spectrophotometer exhibits slightly higher readings across most concentrations, reflecting its greater sensitivity or possibly its ability to detect minor optical density differences. However, the enzymatic reaction played an important role in the conversion of PPi into Pi, as shown in Figures 3 and 4.

Figure 2. Calibration curve of Ercose vs. spectrophotometer The Ercose sensor closely follows the spectrophotometer trend, indicating its reliability for low-cost detection.

Figure 3. Amplification reaction in chemical structural form

Figure 4. Principle of inorganic phosphate (Pi) dye-based detection: Pi is released from the enzyme substrate as a result of enzyme activity The dye reagents (Orange), which turn green in the presence of Pi was added. The X was an amplified DNA sample that contained pyrophosphate (PPi), which was released after nucleotide bases were incorporated into the DNA template. It was subsequently reacted with the enzyme inorganic pyrophosphatase (PPase) to transform it into inorganic phosphate (Pi). PiColorLock^™ dye reagents was react with inorganic phosphate (Pi) to turn the color in green.

Notably, the Ercose system closely follows the spectrophotometer trend, suggesting its potential as a low-cost and reliable alternative for Pi quantification. The small differences in values between the two curves are consistent and fall within acceptable ranges, indicating that Ercose is a valid tool for phosphate measurement, especially in point-of-care settings where spectrophotometers are impractical.

Pi based colorimetric detection of HGSOC associated of OVCAR3 related TP53 gene

Creating a quick, easy-to-use detection system that is sensitive and reliable. For this reason, a quick, simple way to apply and measureable approach for visual detection of the amplified DNA is created. In order to extract the inorganic phosphate from the amplified genomic DNA, RPA was utilized as an amplification method. A yes or no answer can be distinguished with the naked eye thanks to a colorimetric change. It was considerably simpler for the observer to obtain a correct result using this method of Pi detection because the solution’s color changed from colorless to green in the presence of amplification. The picolorlock assay was based on the shift in malachite green dye in the presence of phosphomolybdate complexes, but unlike most malachite dye-based solutions, picolorlock gold delivers a stable end point signal and is not susceptible to precipitation. A unique stabiliser was included in Picolorlock to block nonenzymatic background noise. So, as the strand grew, nucleotides were added one by one during DNA amplification. As a result, pyrophosphate (PPi), which contains two phosphates, was released. The production of PPi would be hydrolyzed into Pi with the prior addition of inorganic pyrophosphatase (PPase). Visual detection was accomplished using only the human eye, and precise reading of samples containing Pi was accomplished using a color sensor device Ercose.

Therefore, there was a critical need to create a detection system that was quick, easy, useful and portable in addition to being sensitive and dependable. For this reason, visual detection may be used as an additional or alternative approach to detect the amplified DNA in Pi form. Visual detection has the advantages of being quick, direct and easily applicable to mass screening. The Pi was detected after amplification using the colorimetric technique and color sensor device Ercose. This approach is easy, straightforward and economical. There are no health-related issues with this procedure. The HGSOC amplified sample with picolorlock reagent is specifically designed to provide sensitive Pi detection.

Ercose device with real time data acquisition and analysis

The Ercose was performed in the dark due to color sensor (TCS3200) sensitivity from light. The eraser was used to give the control light environment for the sample and color sensor device to achieve the required result. Breadboard and arduino pin connections are made using jumper wires. Arduino nano is a flexible, compatible and breadboard friendly microcontroller board that was designed by Arduino.cc in Italy based on ATmega328p (Version 3.0). It has precisely the same capability as arduino UNO but is much smaller in size. The arduino nano can be programmed with the use of arduino software, and it can be controlled via programming. The PLX-DAQ plugin (Parallax Inc., Rocklin, CA, USA) for Microsoft Excel (Microsoft Corporation, Redmond, WA, USA) was used to show real-time data that was transmitted to a computer over a universal serial bus (USB). Alternately, the data can be shared on a smart phone using any data plot application built on an arduino nano. The information collected, stored and distributed by the data collecting system regarding each nucleotide base integrated during DNA synthesis proved very useful. The system offers a full environment for technological interaction and information production, allowing users to see results in real time.

Comparison color sensor with photomultiplier tube (PMT)

A photomultiplier tube (PMT) is an electrical apparatus that amplifies the energy of the photons that strike it into stronger electrical impulses in order to detect weak electromagnetic radiation, often light. The PMT is widely recognized as the industry standard for spectrophotometry in research, including when employing open-surface or digital micro-fluidics, as well as in commercial equipment. A few of the tradeoffs include the mechanical brittleness of PMTs, the requirement for an extraordinarily stable high voltage power supply, the need for cooling to reduce signal-to-noise ratio, the larger size with fewer shape and size options, the susceptibility to external magnetic fields, and the high cost. Although it has been used as an alternative to the PMT, the color sensor has not been standardized for spectrophotometers. The color sensor is far more user-friendly and inexpensive than a PMT.

Detection capability of color sensor

The picolorlock gold reagent with Pi produces the strongest signal at 635 nm, however it is feasible to attain great sensitivity throughout a wide spectrum of wavelengths (590–660 nm). The visual detection method based on the Pi is more stable and doesn’t require any custom labels. The wavelengths are 700 nm. When a color filter is chosen for the TCS3200, it only permits one primary color to pass through while blocking the passage of other primary colors. For instance, when the green filter is chosen, only the green portion of the incident light can through; the blue and red portions are blocked, so that the light intensity of the green light can be obtained. Likewise, by using different filters, one may determine the light intensity of red and blue light. Examine the hue of the light reflected on the TCS3200 sensor using these three values. For colorimeter measurement uses like medical diagnostics, the programmable color light-tofrequency converter TCS3200 is appropriate. White balance is used to define white to the system in terms of color recognition. Although the proportions of the three fundamental hues in white are not quite equal, in theory, white is composed of the same amount of red, green and blue. The RGB output of the TCS3200 light sensor is not equal because of the light sensor’s varying sensitivity to these three primary hues. Therefore, it is required to correct the white balance before to testing in order for the TCS3200 to be equally sensitive to the three primary colors in the detected “white.” In order to recognize colors afterwards, the white balance is adjusted. The device’s specific procedures and techniques for adjusting white balance are as follows. In order for the incident light to reach the TCS3200, place the empty test tube above the sensor and a white light source above the test tube. The red, green, and blue filters are chosen one at a time, and the red, green, and blue values were measured separately. The three adjustment parameters can be determined using the above-described procedure.

Circuit diagram of TCS3200 color sensor module

The TCS3200 color sensor’s circuit schematic is displayed below and is very straightforward and simple to comprehend. A 1K resistor is connected in series with the TCS3200 in the schematic diagram, which also shows 4 LEDs and a 330R current-limiting resistor. This is because the out pin of the integrated circuit has a low impedance. S0 and S1 are being pulled up by two 10K pull-up resistors. A 10uF filter capacitor and a 100nF decoupling capacitor are also present on the board, along with two 0 ohm jumper links.

Drawbacks of Ercose device and improvement strategies

The biggest drawback of the Ercose device is open source, the present form of device was fabricated with different electronics and 3D printed parts. The goal in developing the current design was to demonstrate a color sensor device as proof of concept. To enhance the device future design and functionality, certain tactics can be recommended. The future simple strategy for GUI will be without universal serial bus (USB) to directly connect with cell phone via bluetooth for real time analysis and graphical plotting.

Sensitivity

Color sensors and samples must be read at a constant temperature because they are sensitive to light and temperature. The experiments were carried out at 21–24°C in a control lab environment with regulated lighting and temperature to get around the color sensor issue. The operating range of the TCS3200 color sensor is −40 to 70°C. Most inline color sensors currently in the market are classified as having an accuracy of ΔE of 1–1.5, which is comparable to performance of the human eye. Modern color sensors, however, provide a ΔE of 0.8 at reasonably low-cost levels. People will describe the same hue differently, despite the fact that the human eye is highly good at discriminating colors. For this purpose, used a properly calibrated color-sensing device Ercose to quantify color. The TCS3200 color sensor sensitivity is 0.1 lux to 10,000 lux for light range detection, minimum color difference detection is 5–10% and color resolution is 8 bit per channel.

Cost distribution

The color sensor device used straightforward, widely accessible and extremely affordable components to deliver results that were quite reliable. With a cost comparison of roughly $100200 for PMT while complete spectrophotometer is very expensive, the excellent performanceto-cost ratio of color sensor under $6 may be appreciated as being the cheapest color sensors in the market worldwide. The other parts are a microcontroller ($7.5), a 9 V battery ($1.3), an eraser, jumping wires, and other electronic parts ($4.5). A 3D printed components was estimated to cost $2 and a laser-cut component to cost about $1.2. Other costs include nucleic acid sample and primers ($5.5), RPA (including, DNA polymerase, dNTPs other reagents, etc.) considering a single reaction ($4.5) and pyrophosphatase ($1). For color reagents, the reagent cost per experiment was $2. The proof-of-concept color sensor device and reagents cost about $35 to $40 in total, which is substantially less expensive for a device like a spectrophotometer. This makes the color sensor device Ercose practical in environments with limited resources.

Development of color sensor device

A color sensor device was created using sensor and control electronic, jumper wire, a breadboard, sample holding tube (SHT) and its cover, color sensor and white LED covering tubes and eraser.

Sensing/control electronics

Samples and primer design for RPA amplification

The high grade serous ovarian carcinoma (HGSOC) for TP53 gene sample, and primers were arranged from (IDT, USA). Using the NCBI program, primers were created, with product length 123 bp. The primer was 20 bp in length. The position of the primers was 5–3, with the forward primer (IDT, USA), CCTGGGTGTAGATGATGGGG, and the reverse primer (IDT, USA), CGGGTGGATGTGCAAAGAAG.

RT (Reverse transcription) reaction

Before starting the RT process, 5 μg of total RNA in a 10 μl volume was heated for 5 to 10 minutes at 65°C before being cooled on ice. The following component was set up in a 1.5 ml eppendorf tube then 10.0 μl denatured RNA was warmth, 3.0 μl (10x) PCR buffer (Invitrogen), 2.5 μl (10 mM) dNTPs (Biocompare), 6.0 μl (25 mM) MgCl₂ (Sigma-Aldrich), 1.0 μl (1.5 μg) random primers (Invitrogen), 0.5 μl (200 U/μl) SuperScript II reverse transcriptase (Invitrogen) and 17.0 μl water (Sigma-Aldrich) was used for reverse transcription reaction. The sample was incubated at 42°C for an hour after being left at 25°C for 10 minutes. The cDNA was chilled after being denatured at 95°C.

RPA assay

Recombinase polymerase amplification (RPA), an isothermal amplification method that operates at 37°C to 42°C, is an alternative to the PCR method. RPA just required a very small number of chemicals and equipment. A 5 μl cDNA product was used for RPA reaction by using the TwistAmp^®Basic Kit (TwistDx^™). The concentration of reverse primer was 2.4 μl (10 μM, IDT, USA) and forward primer was 2.4 μl (10 μM, IDT, USA), but the rehydration buffer was 29.5 μl, nuclease free water 12.2 μl (Sigma-Aldrich) and magnesium acetate was 2.5 μl (280 mM) total volume was 54 μl. Positive control was executed to test the activity of kit components. The positive control primer mix was 6 μl, rehydration buffer 29.5 μl, positive control template 10 μl and magnesium acetate was 2.5 μl (280 mM). The template strand for the positive control was 143 bp. The replacement of cDNA and all other reagents with nuclease-free water was used as a negative control. At 42°C, the RPA experimental reaction was carried out in a water bath at JOANLAB in China. RPA’s ability to do tasks without the need for expensive equipment is one of its primary advantages.

Detection of inorganic phosphate (Pi)

The Picolorlock kit (Innova Biosciences) was used for a colorimetric approach. The HGSOC amplified sample 9 μl was utilized to detect inorganic phosphate (Pi), the test was quick and simple to carry out, and it also required minimal chemicals and equipment. After amplification reaction, the nuclease free water was added 2.8 μl with inorganic pyrophosphatase (NEB) 2 units of 0.2 μl was used to hydrolyze the pyrophosphate (PPi) into inorganic phosphate (Pi). Follow the sample to prepare the reagents as a picolorlock gold was 15 μl, stabilizer was 6 μl and accelerator was0.6 μl. Total volume was 33.6 μl in each PCR tube to add 20.4 μl distilled water to made it 54 μl for colorimetric detection, in negative control and PPase skipped reagent described in Tables 1 and 2 replace with distilled water to make total volume 54 μl.

Procedure

Accelerator and Picolorlock Gold were combined in this experiment. Accelerator aids in accelerating the reaction while the picolorlock gold aids in changing the reaction’s color. The HGSOC amplified sample was combined with the picolorlock gold and accelerator after amplification, which caused the solution’s color change to green. These reagents changed color when Pi was present, and the amount of Pi released from a substrate may be determined using a straightforward absorbance reading. However, remember to add the stabiliser last. Avoid mixing the accelerator and Picolorlock Gold immediately with the stabiliser. The picolorlock assay is based on the change in malachite green dye absorbance in the presence of phosphomolybdate complexes, however in contrast to most solutions based on malachite dye, picolorlock gold provided a stable end point signal and it was not easily prone to precipitate.

Negative control

A negative control was essentially an experiment carried out concurrently with a major experiment using identical methods, with the exception that the treatment was altered to something that was expected to have no result. Negative control solution was 54 μl with nuclease free water 2.8 μl and inorganic pyrophosphatase (NEB) was 2 units of 0.2 μl that was used to check the inorganic phosphate with the help of picolorlock reagents, picolorlock reagents was used 15 μl picolorlock gold, 6 μl stabilizer but the accelerator was 0.6 μl, used the distilled water to complete the total volume 54 μl.